-Please read each multiple choice, true/false, or short answer question carefully. Answer short-answer questions completely but please be concise. Points maybe deducted for excessive wordiness or if additional information not relevant to the question is given.
-Highlight the correct answer for multiple choice questions in yellow. Also highlight all other answers (short answer, True/False, etc) in yellow.
– You could use the attched “Merged lectures” as a source, or you could use you own sources.
Questions:
List the following in order from smallest to largest based on size of the molecule, region or structure: 1p, 6q26, base pair, chromosome 1, chromosome 22, codon, diploid human genome, exon, gene, haploid human genome, intron, nucleoside, nucleotide, purine base, pyrimidine baseTranslation starts and finishes within the portion of the mRNA sequence below from the hypothetical gene, XYZ. Give the predicted amino acid sequence (single-letter or three-letter abbreviations).CUUGAAUUCUUUGAACGAACAUCGAUGAGUGUUCCAAGAGGGGCACUUCAUCACUAGUCUACCGUCUAU
The gene above is sequenced in a patient A and patient B, both suspected of having a genetic disease caused by mutations in this gene. Describe the variant/mutation found in each patient and classify each with using the following terms when appropriate (SNV, CNV, nonsense, missense, silent, frameshift, in-frame, deletion, insertion, transition, transversion, inversion, translocation, trisomy, monosomy, amplification)patient A:
CTTGAATTCTTTGAACGAACATCGATGAGTGTTCCATGAGGGGCACTTCATCACTAGTCTACCGTCTAT
patient B:CTTGAATTCTTTGAACGAACATCGATGAGTGTTCCACGAGGGGCACTTCATCACTAGTCTACCGTCTAT
Based on the information provided in the previous question, is it more likely that patient A or patient B has the genetic disease associated with XYZ? Why?
At a particular locus, how many alleles could you have in common with a sibling (same biological parents)?121 or 20, 1 or 2
List three components or molecules needed for transcription.List three ways RNA differs from DNA.
Which best describes “redundancy” of the genetic code?all organism use the same genetic codea single amino acid can be coded for by multiple codonsthe use of RNA as an intermediate in the genetic code evolved separately in different organismsThe same nucleotide is often repeated several times in the exons of protein coding genes
Which components can be found within exons?stop codons and intronspromoters and start codonspolyadenylation signal and stop codonpoly-A tail and 5’ untranslated region
Which could be found in an intron?missense mutationbenign SNVnonsense mutationstop codon
Describe the difference between a missense and frameshift variant. What is the impact of each on the DNA sequence and protein sequence?Which term could be used to describe the variant, “c.135A>C”?silentdeletiontransitioninversion
Sequencing of cancer tissue reveals a somatic variant/mutation involving a tumor suppressor gene. Which term would most likely describe this variant?deletionamplificationsilentchimeric
DNA is extracted from two peripheral whole blood specimens and evaluated by UV spectrophotometry. Give the absorbance measurements below, which sample might be less suitable for PCR testing?sample #1: 260 nm = 0.85; 280 nm = 1.6sample #2: 260 nm = 0.61; 280 nm = 0.32
What explanation gives the most convincing explanation for the condition of the less suitable DNA sample in the previous question?Storage of the DNA samples for more than one month at room temperatureExposure of the sample to ionizing radiationContaminating RNAEluting DNA with too much TE bufferInsufficient washing of magnetic beads during DNA extraction
All of the following are required for both PCR and Southern blotting EXCEPT:enzymehybridizationtarget amplificationDNA being tested
In traditional (endpoint) PCR, why is testing usually not finished immediately after thermal cycling?
A PCR is performed to amplify a target sequence in genomic DNA prior to Sanger sequencing for 200 different patient samples. The PCR works as expected for all but one sample (John Doe) in which the target sequence did not amplified. Which explanation makes most sense?John Doe’s DNA sample was isolated from blood drawn in a sodium heparin (green-top) tube.John Doe’s DNA sample was isolated from frozen tissueJohn Doe’s DNA sample became contaminated with PCR product (amplicon) from the last time the same PCR was runA negative control was not run
List 3 ways the set-up and running of real-time PCR differs from traditional/endpoint PCR.
List 3 things real-time PCR and traditional/endpoint PCR have in common.
List 3 benefits of real-time PCR over traditional PCR.
Give the values from figure above:Ct: _________threshold: __________Number of PCR cycles: ________Which is true of real-time PCR with Taqman probes?It requires a polymerase with 5’-3’ endonuclease activityTwo different oligonucleotide probes are requiredIncreased specificity over SYBR green real-time PCRAll of the above
Which is true of performing real-time PCR with SYBR green?besides the two primers, no other oligonucleotides are neededit requires fluorescent detectionit can be cheaper than other real-time PCR methodsAll of the above
A couple has a child with cystic fibrosis and later has another child that does not have cystic fibrosis. What is the probability the second child is a carrier?100%66%50%25%0%A newborn child is diagnosed with cystic fibrosis and Tay Sachs disease, two autosomal recessive diseases. Both parents are evaluated and neither has symptoms of either disease. Which scenario best explains the child’s condition?Neither parent harbors mutations for cystic fibrosis or Tay Sachs. The mutations in the child occurred de novo.Both parents are compound heterozygotes.Both parents are double heterozygotes.The child is male and the genes mutated are both on the X chromosome.
If a man in known to be a carrier for the deltaF508 mutation in the CFTR gene and his partner is tested for the deltaF508 mutation and it is not detected, the couple can be assured they won’t have a child with cystic fibrosis.TrueFalse
The xTAG Cystic Fibrosis Assay uses a multiplex PCR becausethe CFTR gene is so largethe assay must detect a large number of mutationsCFTR mutations are relatively common in the Caucasian populationthere are a large number of pathogenic organisms that tend to colonize the lungs of CF patients
Recently, several rapid, single sample molecular tests have been approved for infectious disease testing but this trend does not seem to be as common for genetic testing. Why?Bacteria and viruses replicate quickly making them easier to detect by PCR than human genomic targets.DNA from microbes has more repetitive sequences which makes it a better target for PCR.Microbial genomes are generally much smaller than the human genomes.Reporting results in hours instead of days for genetic testing does not impact patient care as much as for molecular infectious disease testing.
BG2 is a human gene that is used as an internal control in the GeneXpert MRSA PCR. The reason that BG2 is used is…To ensure proper specimen collection and help rule-out a false-negative due to PCR inhibitorsto distinguish human specimens from animal specimens since MRSA infections are common in pets and farm animalsthe test is performed in a single-sample cartridge. Separate MRSA-positive batch controls are not possible.to make the test quantitative
Which statement is true concerning HPV and cervical cancerAll HPV infections lead to cervical cancerAll cervical cancers are associated with HPVHPV-associated cervical cancer is more deadly than cervical cancer not associated with HPVHPV 6, 11, 42, 43 and 44 are most closely associated with cervical cancer
Quantitative viral testing…is rarely clinically relevantcan be performed by real-time PCR with a standard curveis possible with real-time PCR but rarely uses Ct valuesis possible with real-time PCR but require SYBR greenAll of the following are associated with microarrays EXCEPT:probesmultiplexinghybridizationreal-time PCR
Which is not a common application of microarray technologyNext generation sequencinggenotypinggene expressionCNV detection
What is one advantage that chromosomal microarrays (CMAs) have over traditional karyotype?higher resolutionbetter detection of translocationsfewer variants of uncertain significancecan detect novel point mutations
List 4 abnormalities that can be detected with SNP-based CMAs.
Why is there a shift from three tracks to two in the allele peaks (SNP data) in the CMA data shown below?Long stretches of homozygosity detected by a SNP-based CMA could indicate all of the following EXCEPTconsanguinitychimerismuniparental disomyrisk for autosomal recessive diseasesA Sanger sequencing reaction includes many of the same components as PCR. In which ways are the two similar?ddNTPsexponential amplificationtwo primers per reactionthermal cyclingall of the above
A germline mutation can be detected insperm or eggsbloodbreast tissuetumor tissueall of the aboveAn increased depth of coverage in next-generation sequencing is generally associated withmore genes being sequencedincreased sensitivity for low-level variantssequencing all the exons in a geneincreased rates of false-positives
For any questions, feedback, or comments, we have an ethical customer support team that is always waiting on the line for your inquiries.